Opsin PCR primers

We have developed a number of primers for different applications for cichlid opsin genes. These were used in Carleton and Kocher 2001; Parry et al 2005 and later work. They include primers for:

  • genomic DNA amplification and sequencing
  • Taqman qPCR
  • basic cloning and sequencing

    Genomic primers

    There is one rod opsin and seven cichlid cone opsin genes. We have named the cone opsin genes SWS1, SWS2b, SWS2a, RH2b, RH2a&beta, RH2a&alpha, and LWS. The rod opsin has no introns. The cone opsins have 4 introns except for the LWS gene which has 5. Depending on intron size, we amplify the genes in one, two or three pieces. The amplification and sequencing strategy is as follows:

    Gene Primers to amplify Sequencing primers Notes
    SWS1= UV F1a to R4 F1a, R1a, F2, R2, F4, R4 One piece
    SWS2b= Blue2 (violet) F3bb to R2b
    F2b to R1bb
    F1b to R4b
    F3bb, F3c, R2b
    F2b, R1bb
    F1b, R4b
    Piece 1
    Piece 2
    Piece 3
    SWS2a= Blue1 F3 to R1a
    F1a to R4
    F3, F2, R3, R1a
    F1a, R4
    Piece 1
    Piece 2
    RH2b= Green3 F1a to R2a
    F2a to R4
    F1a, R2a
    F2a, F4, R3, R4
    Piece 1
    Piece 2
    Leaves out 1.5 kb intron 2
    RH2a&beta= Green1 F1a to R4 F1a, R1a, F2, R3, F4, R4 One piece; Green F1a and R4 are unique to Green1 but other primers also work in Green 2
    RH2a&alpha= Green2 Green2 F1a to R4 G2F1a, R1a, F2, R3, F4, G2R4 One piece; Green2 F1a and R4 are unique to Green2 but other primers come from Green 1
    LWS= Red F0a to R0
    F1a to R2
    F3 to R4
    F0a, F0b, R0a, R0
    F1a, R2
    F3, R4
    Piece 1
    Piece 2
    Piece 3
    Intron 0 is 1 kb and repetative

    A map showing the layout of the exons, introns and primers is given here for : Green and Rh and Blue and red.

    Many of the primers have tails on each end which incorporate restriction sites. Typically these are:
    Forward primer tail with EcoRI: GCGCGGAATTC
    Reverse primer tail with HindIII: GCGCGCAAGCTT
    The tails give the primers slightly higher annealing temperatures and help with amplifying longer products.
    The primers are listed here:
    Gene Primer Sequence Notes
    SWS1 UV F1a GCGCGGAATTCAAAGAGCTCAGGGTCACAATG
    UV R1a GCGCGCAAGCTTCCCATGAACCAGGTGAAGG
    UV F2 GCGCGGAATTCGTGACCGCCTGGTCTTTG
    UV R2 GCGCGCAAGCTTAGCAGCTGGGAGTAGCAGAA
    UV F4 GCGCGGAATTCAGTCAGCCTCCACCCAGAAG
    UV R4 GCGCGCAAGCTTGCTCAGTCAACGCCCTCTTA
    UV F3 GCGCGGAATTCACATCCCTGAAAGTCTGGGC usat repeat btn F3 and R3 so these are not used for sequencing
    UV R3 GCGCGCAAGCTTCTGTTTGTTCATGAAGACGTAGA
    SWS2b Blue2 F3bb GCGCGGAATTCTAGATTTTGATCGCAAACTCCAT
    Blue2 F3c TGCATGCAAGATTGAAGGAT
    Blue2 R2b CCAAACAGAGGTGGAAGTGC
    Blue2 F2b GCTTGTGGTCTCTTGCTGTGG
    Blue2 R1bb GCGCGCAAGCTTCGGTTATTCACAACCCAGATG
    Blue2 F1b GATTATGGTGCTGGGCTTTC
    Blue2 R4b CAGTATGCGAGCTGTCCAAA
    SWS2a Blue1 F3 GCGCGGAATTCGCGCGATACCTAATTTGAGC
    Blue1 F2 GCGCGGAATTCTGTGGTCCCTTGCTGTGATA
    Blue1 R3 GCGCGCAAGCTTGATGAGCAGCTGGGAGTAGC
    Blue1 R1a GCGCGCAAGCTTAGCCTTTGAGAAACAGGACG
    Blue1 F1a GCGCGGAATTCGCAGAGAGGGAAGTGACCAG
    Blue1 R4 GCGCGCAAGCTTAAATCAGCGAGCATTGACG
    RH2B Green3 F1a CAGTACTCCAAGGAGCTTAGCAG
    Green3 R2a GCCATTCCAGACATGGGTAG In intron 2 - works in some Malawi
    Green3 F2a CCTGATACTTCATATTCAACTAACCTT in intron 2
    Green3 F4 TGCATCCCAACAGCAGGAC
    Green3 R3 TGCACATGCGTGTCACTTCCT
    Green3 R4 CAGGAAGGAGTATGGCTGGA
    Green3 RH2cInt2F TTCCCAAAGCTTGAATTATAAAAA In exon 2 to amplify intron 2 (1.5kb)
    Green3 RH2cInt2R AGGTCCACAGGAAACCTGAA In exon 3 to amplify intron 2
    RH2A&beta Green 1 F1a GCGCGGAATTCGGGATATTCCATCAGCTGAAAC
    Green1 R1a GCGCGCAAGCTTGGACCATCCAAAGAGTGGAG
    Green1 F2 GCGCGGAATTCGGTCACTTGTTGTCCTGGCT
    Green1 R3 GCGCGCAAGCTTAGCACGTAGATAACAGGGTTGT
    Green1 F4 GCGCGGAATTCCTGAGAAGGAAGTGACCCGT
    Green1 R4 GCGCGCAAGCTTGCTTCTTAAATCCATTTGGCA
    RH2A&alpha Green 2 F1a ACGCAGACTCAACTAAACAGC
    Green2 R4 GGAAGCAATCATCAATGTCCA
    LWS Red F0a GCGCGGAATTCGGCTAACAGCTCAGGACCTC Amplify 1 kb Intron #0
    Red F0b AAACTGTTTTCGACCAGTGT
    Red R0a CGAGACCGTTGGTGAAGACT
    Red R0 GCGCGCAAGCTTGCCCTCAAAGATACACATTGG
    Red F1a GCGCGGAATTCTTTGAGGGTCCCAATTACCA
    Red R2 GCGCGCAAGCTTTCCACACAGCAAGGTAGCAC
    Red F3 GCGCGGAATTCACTGGCCTCATGGACTGAAG
    Red R4 GCGCGCAAGCTTTCCCAAAATGGAGAACATGG
    Red R3 Vic GCGCGCAAGCTTGTATGCAGGCATAGCAGCAG For Victoria cichlids
    RH1 RH F1b GGCTGATCGCAACCACAAG
    RH F4 GAAACCACCCAGAGGGCTGA
    RH R1a TGCCCTCAGGGATGTTACGA
    RH R4 GGAGCAGAAGTCTTCGTCTTGG

     

    KC 5/09